ID: 1123434683

View in Genome Browser
Species Human (GRCh38)
Location 15:20246618-20246640
Sequence TGCAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 859226
Summary {0: 5425, 1: 297008, 2: 267045, 3: 155244, 4: 134504}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434683_1123434689 8 Left 1123434683 15:20246618-20246640 CCTCCCAAAGTGCTGGGATTGCA 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434683_1123434687 4 Left 1123434683 15:20246618-20246640 CCTCCCAAAGTGCTGGGATTGCA 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061
1123434683_1123434694 21 Left 1123434683 15:20246618-20246640 CCTCCCAAAGTGCTGGGATTGCA 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
Right 1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434683 Original CRISPR TGCAATCCCAGCACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr