ID: 1123434685

View in Genome Browser
Species Human (GRCh38)
Location 15:20246621-20246643
Sequence GCCTGCAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 830055
Summary {0: 3798, 1: 223380, 2: 272418, 3: 185829, 4: 144630}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434685_1123434694 18 Left 1123434685 15:20246621-20246643 CCCAAAGTGCTGGGATTGCAGGC 0: 3798
1: 223380
2: 272418
3: 185829
4: 144630
Right 1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG No data
1123434685_1123434687 1 Left 1123434685 15:20246621-20246643 CCCAAAGTGCTGGGATTGCAGGC 0: 3798
1: 223380
2: 272418
3: 185829
4: 144630
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061
1123434685_1123434689 5 Left 1123434685 15:20246621-20246643 CCCAAAGTGCTGGGATTGCAGGC 0: 3798
1: 223380
2: 272418
3: 185829
4: 144630
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434685 Original CRISPR GCCTGCAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr