ID: 1123434686

View in Genome Browser
Species Human (GRCh38)
Location 15:20246622-20246644
Sequence TGCCTGCAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 788756
Summary {0: 1924, 1: 94869, 2: 232667, 3: 241891, 4: 217405}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434686_1123434687 0 Left 1123434686 15:20246622-20246644 CCAAAGTGCTGGGATTGCAGGCA 0: 1924
1: 94869
2: 232667
3: 241891
4: 217405
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061
1123434686_1123434689 4 Left 1123434686 15:20246622-20246644 CCAAAGTGCTGGGATTGCAGGCA 0: 1924
1: 94869
2: 232667
3: 241891
4: 217405
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434686_1123434694 17 Left 1123434686 15:20246622-20246644 CCAAAGTGCTGGGATTGCAGGCA 0: 1924
1: 94869
2: 232667
3: 241891
4: 217405
Right 1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434686 Original CRISPR TGCCTGCAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr