ID: 1123434689

View in Genome Browser
Species Human (GRCh38)
Location 15:20246649-20246671
Sequence CCACCACACCCAGCCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434679_1123434689 17 Left 1123434679 15:20246609-20246631 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434681_1123434689 14 Left 1123434681 15:20246612-20246634 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434678_1123434689 18 Left 1123434678 15:20246608-20246630 CCCACCTCAGCCTCCCAAAGTGC 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434685_1123434689 5 Left 1123434685 15:20246621-20246643 CCCAAAGTGCTGGGATTGCAGGC 0: 3798
1: 223380
2: 272418
3: 185829
4: 144630
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434677_1123434689 21 Left 1123434677 15:20246605-20246627 CCTCCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434686_1123434689 4 Left 1123434686 15:20246622-20246644 CCAAAGTGCTGGGATTGCAGGCA 0: 1924
1: 94869
2: 232667
3: 241891
4: 217405
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434683_1123434689 8 Left 1123434683 15:20246618-20246640 CCTCCCAAAGTGCTGGGATTGCA 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434689 Original CRISPR CCACCACACCCAGCCAAGGA AGG Intergenic
No off target data available for this crispr