ID: 1123439907

View in Genome Browser
Species Human (GRCh38)
Location 15:20282622-20282644
Sequence TCCCTGTTCCTCCTACGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123439907_1123439908 27 Left 1123439907 15:20282622-20282644 CCTCGACGTAGGAGGAACAGGGA No data
Right 1123439908 15:20282672-20282694 GCGCCTCTCTGCGCCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123439907 Original CRISPR TCCCTGTTCCTCCTACGTCG AGG (reversed) Intergenic
No off target data available for this crispr