ID: 1123441474

View in Genome Browser
Species Human (GRCh38)
Location 15:20295076-20295098
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441474_1123441479 -4 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441479 15:20295095-20295117 AGCTCGAGGCGGACGCGGCCCGG No data
1123441474_1123441484 19 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441484 15:20295118-20295140 ACCCCGTGGATATGGAGCAGTGG No data
1123441474_1123441481 11 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441481 15:20295110-20295132 CGGCCCGGACCCCGTGGATATGG No data
1123441474_1123441480 5 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441480 15:20295104-20295126 CGGACGCGGCCCGGACCCCGTGG No data
1123441474_1123441488 29 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data
1123441474_1123441478 -9 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441478 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441474 Original CRISPR AGCTAACGGTCCCACCAGCT AGG (reversed) Intergenic