ID: 1123441477

View in Genome Browser
Species Human (GRCh38)
Location 15:20295090-20295112
Sequence CCGCGTCCGCCTCGAGCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441477_1123441488 15 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data
1123441477_1123441481 -3 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441481 15:20295110-20295132 CGGCCCGGACCCCGTGGATATGG No data
1123441477_1123441484 5 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441484 15:20295118-20295140 ACCCCGTGGATATGGAGCAGTGG No data
1123441477_1123441480 -9 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441480 15:20295104-20295126 CGGACGCGGCCCGGACCCCGTGG No data
1123441477_1123441489 27 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441477 Original CRISPR CCGCGTCCGCCTCGAGCTAA CGG (reversed) Intergenic