ID: 1123441479

View in Genome Browser
Species Human (GRCh38)
Location 15:20295095-20295117
Sequence AGCTCGAGGCGGACGCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441471_1123441479 8 Left 1123441471 15:20295064-20295086 CCGGCGCACGCGCCTAGCTGGTG No data
Right 1123441479 15:20295095-20295117 AGCTCGAGGCGGACGCGGCCCGG No data
1123441474_1123441479 -4 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441479 15:20295095-20295117 AGCTCGAGGCGGACGCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441479 Original CRISPR AGCTCGAGGCGGACGCGGCC CGG Intergenic