ID: 1123441479 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:20295095-20295117 |
Sequence | AGCTCGAGGCGGACGCGGCC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123441474_1123441479 | -4 | Left | 1123441474 | 15:20295076-20295098 | CCTAGCTGGTGGGACCGTTAGCT | No data | ||
Right | 1123441479 | 15:20295095-20295117 | AGCTCGAGGCGGACGCGGCCCGG | No data | ||||
1123441471_1123441479 | 8 | Left | 1123441471 | 15:20295064-20295086 | CCGGCGCACGCGCCTAGCTGGTG | No data | ||
Right | 1123441479 | 15:20295095-20295117 | AGCTCGAGGCGGACGCGGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123441479 | Original CRISPR | AGCTCGAGGCGGACGCGGCC CGG | Intergenic | ||