ID: 1123441480 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:20295104-20295126 |
| Sequence | CGGACGCGGCCCGGACCCCG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123441474_1123441480 | 5 | Left | 1123441474 | 15:20295076-20295098 | CCTAGCTGGTGGGACCGTTAGCT | No data | ||
| Right | 1123441480 | 15:20295104-20295126 | CGGACGCGGCCCGGACCCCGTGG | No data | ||||
| 1123441471_1123441480 | 17 | Left | 1123441471 | 15:20295064-20295086 | CCGGCGCACGCGCCTAGCTGGTG | No data | ||
| Right | 1123441480 | 15:20295104-20295126 | CGGACGCGGCCCGGACCCCGTGG | No data | ||||
| 1123441477_1123441480 | -9 | Left | 1123441477 | 15:20295090-20295112 | CCGTTAGCTCGAGGCGGACGCGG | No data | ||
| Right | 1123441480 | 15:20295104-20295126 | CGGACGCGGCCCGGACCCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123441480 | Original CRISPR | CGGACGCGGCCCGGACCCCG TGG | Intergenic | ||