ID: 1123441481

View in Genome Browser
Species Human (GRCh38)
Location 15:20295110-20295132
Sequence CGGCCCGGACCCCGTGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441474_1123441481 11 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441481 15:20295110-20295132 CGGCCCGGACCCCGTGGATATGG No data
1123441471_1123441481 23 Left 1123441471 15:20295064-20295086 CCGGCGCACGCGCCTAGCTGGTG No data
Right 1123441481 15:20295110-20295132 CGGCCCGGACCCCGTGGATATGG No data
1123441477_1123441481 -3 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441481 15:20295110-20295132 CGGCCCGGACCCCGTGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441481 Original CRISPR CGGCCCGGACCCCGTGGATA TGG Intergenic
No off target data available for this crispr