ID: 1123441482

View in Genome Browser
Species Human (GRCh38)
Location 15:20295113-20295135
Sequence GCTCCATATCCACGGGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441482_1123441499 27 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441482_1123441489 4 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441482_1123441493 11 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
1123441482_1123441494 12 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data
1123441482_1123441488 -8 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441482 Original CRISPR GCTCCATATCCACGGGGTCC GGG (reversed) Intergenic
No off target data available for this crispr