ID: 1123441484

View in Genome Browser
Species Human (GRCh38)
Location 15:20295118-20295140
Sequence ACCCCGTGGATATGGAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441474_1123441484 19 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441484 15:20295118-20295140 ACCCCGTGGATATGGAGCAGTGG No data
1123441477_1123441484 5 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441484 15:20295118-20295140 ACCCCGTGGATATGGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441484 Original CRISPR ACCCCGTGGATATGGAGCAG TGG Intergenic
No off target data available for this crispr