ID: 1123441487

View in Genome Browser
Species Human (GRCh38)
Location 15:20295121-20295143
Sequence CGGCCACTGCTCCATATCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441487_1123441502 28 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441487_1123441489 -4 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441487_1123441493 3 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
1123441487_1123441499 19 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441487_1123441494 4 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441487 Original CRISPR CGGCCACTGCTCCATATCCA CGG (reversed) Intergenic