ID: 1123441488

View in Genome Browser
Species Human (GRCh38)
Location 15:20295128-20295150
Sequence TATGGAGCAGTGGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441474_1123441488 29 Left 1123441474 15:20295076-20295098 CCTAGCTGGTGGGACCGTTAGCT No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data
1123441477_1123441488 15 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data
1123441483_1123441488 -9 Left 1123441483 15:20295114-20295136 CCGGACCCCGTGGATATGGAGCA No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data
1123441482_1123441488 -8 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441488 Original CRISPR TATGGAGCAGTGGCCGCCGC CGG Intergenic
No off target data available for this crispr