ID: 1123441489

View in Genome Browser
Species Human (GRCh38)
Location 15:20295140-20295162
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441487_1123441489 -4 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441485_1123441489 -2 Left 1123441485 15:20295119-20295141 CCCCGTGGATATGGAGCAGTGGC No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441482_1123441489 4 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441483_1123441489 3 Left 1123441483 15:20295114-20295136 CCGGACCCCGTGGATATGGAGCA No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441477_1123441489 27 Left 1123441477 15:20295090-20295112 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data
1123441486_1123441489 -3 Left 1123441486 15:20295120-20295142 CCCGTGGATATGGAGCAGTGGCC No data
Right 1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441489 Original CRISPR GCCGCCGCCGGCGCCCGAGC CGG Intergenic
No off target data available for this crispr