ID: 1123441493

View in Genome Browser
Species Human (GRCh38)
Location 15:20295147-20295169
Sequence CCGGCGCCCGAGCCGGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441487_1123441493 3 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
1123441486_1123441493 4 Left 1123441486 15:20295120-20295142 CCCGTGGATATGGAGCAGTGGCC No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
1123441485_1123441493 5 Left 1123441485 15:20295119-20295141 CCCCGTGGATATGGAGCAGTGGC No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
1123441482_1123441493 11 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
1123441483_1123441493 10 Left 1123441483 15:20295114-20295136 CCGGACCCCGTGGATATGGAGCA No data
Right 1123441493 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441493 Original CRISPR CCGGCGCCCGAGCCGGCCCA AGG Intergenic