ID: 1123441494

View in Genome Browser
Species Human (GRCh38)
Location 15:20295148-20295170
Sequence CGGCGCCCGAGCCGGCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441483_1123441494 11 Left 1123441483 15:20295114-20295136 CCGGACCCCGTGGATATGGAGCA No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data
1123441486_1123441494 5 Left 1123441486 15:20295120-20295142 CCCGTGGATATGGAGCAGTGGCC No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data
1123441487_1123441494 4 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data
1123441485_1123441494 6 Left 1123441485 15:20295119-20295141 CCCCGTGGATATGGAGCAGTGGC No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data
1123441482_1123441494 12 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441494 15:20295148-20295170 CGGCGCCCGAGCCGGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441494 Original CRISPR CGGCGCCCGAGCCGGCCCAA GGG Intergenic