ID: 1123441499

View in Genome Browser
Species Human (GRCh38)
Location 15:20295163-20295185
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441483_1123441499 26 Left 1123441483 15:20295114-20295136 CCGGACCCCGTGGATATGGAGCA No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441482_1123441499 27 Left 1123441482 15:20295113-20295135 CCCGGACCCCGTGGATATGGAGC No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441492_1123441499 -7 Left 1123441492 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441486_1123441499 20 Left 1123441486 15:20295120-20295142 CCCGTGGATATGGAGCAGTGGCC No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441487_1123441499 19 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441490_1123441499 -1 Left 1123441490 15:20295141-20295163 CCGCCGCCGGCGCCCGAGCCGGC No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441485_1123441499 21 Left 1123441485 15:20295119-20295141 CCCCGTGGATATGGAGCAGTGGC No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data
1123441491_1123441499 -4 Left 1123441491 15:20295144-20295166 CCGCCGGCGCCCGAGCCGGCCCA No data
Right 1123441499 15:20295163-20295185 CCCAAGGGCCGACCCCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441499 Original CRISPR CCCAAGGGCCGACCCCCGCA AGG Intergenic
No off target data available for this crispr