ID: 1123441502

View in Genome Browser
Species Human (GRCh38)
Location 15:20295172-20295194
Sequence CGACCCCCGCAAGGAGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123441491_1123441502 5 Left 1123441491 15:20295144-20295166 CCGCCGGCGCCCGAGCCGGCCCA No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441487_1123441502 28 Left 1123441487 15:20295121-20295143 CCGTGGATATGGAGCAGTGGCCG No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441495_1123441502 -4 Left 1123441495 15:20295153-20295175 CCCGAGCCGGCCCAAGGGCCGAC No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441492_1123441502 2 Left 1123441492 15:20295147-20295169 CCGGCGCCCGAGCCGGCCCAAGG No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441490_1123441502 8 Left 1123441490 15:20295141-20295163 CCGCCGCCGGCGCCCGAGCCGGC No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441497_1123441502 -10 Left 1123441497 15:20295159-20295181 CCGGCCCAAGGGCCGACCCCCGC No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441496_1123441502 -5 Left 1123441496 15:20295154-20295176 CCGAGCCGGCCCAAGGGCCGACC No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441485_1123441502 30 Left 1123441485 15:20295119-20295141 CCCCGTGGATATGGAGCAGTGGC No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data
1123441486_1123441502 29 Left 1123441486 15:20295120-20295142 CCCGTGGATATGGAGCAGTGGCC No data
Right 1123441502 15:20295172-20295194 CGACCCCCGCAAGGAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123441502 Original CRISPR CGACCCCCGCAAGGAGCTGA AGG Intergenic