ID: 1123443438

View in Genome Browser
Species Human (GRCh38)
Location 15:20305821-20305843
Sequence GTCCAGCTCTGGCCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123443438_1123443444 18 Left 1123443438 15:20305821-20305843 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 1123443444 15:20305862-20305884 GATTTGCCCTGCCCCAACGTTGG No data
1123443438_1123443442 -8 Left 1123443438 15:20305821-20305843 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 1123443442 15:20305836-20305858 AGCTGGACTTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123443438 Original CRISPR GTCCAGCTCTGGCCCTGCCT TGG (reversed) Intergenic
No off target data available for this crispr