ID: 1123443441

View in Genome Browser
Species Human (GRCh38)
Location 15:20305832-20305854
Sequence GACACCTCCAAGTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123443441_1123443450 23 Left 1123443441 15:20305832-20305854 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1123443450 15:20305878-20305900 ACGTTGGCCCAGCCCTGCTCTGG No data
1123443441_1123443444 7 Left 1123443441 15:20305832-20305854 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1123443444 15:20305862-20305884 GATTTGCCCTGCCCCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123443441 Original CRISPR GACACCTCCAAGTCCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr