ID: 1123443444

View in Genome Browser
Species Human (GRCh38)
Location 15:20305862-20305884
Sequence GATTTGCCCTGCCCCAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123443438_1123443444 18 Left 1123443438 15:20305821-20305843 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 1123443444 15:20305862-20305884 GATTTGCCCTGCCCCAACGTTGG No data
1123443436_1123443444 24 Left 1123443436 15:20305815-20305837 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1123443444 15:20305862-20305884 GATTTGCCCTGCCCCAACGTTGG No data
1123443441_1123443444 7 Left 1123443441 15:20305832-20305854 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1123443444 15:20305862-20305884 GATTTGCCCTGCCCCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123443444 Original CRISPR GATTTGCCCTGCCCCAACGT TGG Intergenic
No off target data available for this crispr