ID: 1123445262

View in Genome Browser
Species Human (GRCh38)
Location 15:20326164-20326186
Sequence CGCTGGCTGAGGTGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123445262_1123445265 -10 Left 1123445262 15:20326164-20326186 CCTGGACTTCACCTCAGCCAGCG No data
Right 1123445265 15:20326177-20326199 TCAGCCAGCGAAGGAAAGAGAGG No data
1123445262_1123445268 11 Left 1123445262 15:20326164-20326186 CCTGGACTTCACCTCAGCCAGCG No data
Right 1123445268 15:20326198-20326220 GGGTTAATGTTAACTGCACGAGG No data
1123445262_1123445266 -9 Left 1123445262 15:20326164-20326186 CCTGGACTTCACCTCAGCCAGCG No data
Right 1123445266 15:20326178-20326200 CAGCCAGCGAAGGAAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123445262 Original CRISPR CGCTGGCTGAGGTGAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr