ID: 1123445464

View in Genome Browser
Species Human (GRCh38)
Location 15:20327584-20327606
Sequence GGGGAGGTGGCCTGAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123445464_1123445476 23 Left 1123445464 15:20327584-20327606 CCAGGAACTCAGGCCACCTCCCC No data
Right 1123445476 15:20327630-20327652 CCAGGCATGTGCTGAGTGCCTGG No data
1123445464_1123445471 5 Left 1123445464 15:20327584-20327606 CCAGGAACTCAGGCCACCTCCCC No data
Right 1123445471 15:20327612-20327634 AGCCCTGCACCATGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123445464 Original CRISPR GGGGAGGTGGCCTGAGTTCC TGG (reversed) Intergenic