ID: 1123450551

View in Genome Browser
Species Human (GRCh38)
Location 15:20357061-20357083
Sequence GTCCCACGGGAGGCCCGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123450542_1123450551 8 Left 1123450542 15:20357030-20357052 CCTCGGTCAATGGAAGCTGCTCT No data
Right 1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG No data
1123450540_1123450551 14 Left 1123450540 15:20357024-20357046 CCCTGACCTCGGTCAATGGAAGC No data
Right 1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG No data
1123450539_1123450551 15 Left 1123450539 15:20357023-20357045 CCCCTGACCTCGGTCAATGGAAG No data
Right 1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG No data
1123450541_1123450551 13 Left 1123450541 15:20357025-20357047 CCTGACCTCGGTCAATGGAAGCT No data
Right 1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123450551 Original CRISPR GTCCCACGGGAGGCCCGTGA TGG Intergenic
No off target data available for this crispr