ID: 1123456125

View in Genome Browser
Species Human (GRCh38)
Location 15:20427672-20427694
Sequence CCCCTACTGACCTCCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123456125_1123456133 11 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456133 15:20427706-20427728 CAGAGGAGAATGGAAATCCCTGG No data
1123456125_1123456137 19 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456137 15:20427714-20427736 AATGGAAATCCCTGGGGAATGGG No data
1123456125_1123456139 28 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456139 15:20427723-20427745 CCCTGGGGAATGGGCATCTATGG No data
1123456125_1123456134 12 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456134 15:20427707-20427729 AGAGGAGAATGGAAATCCCTGGG No data
1123456125_1123456135 13 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456135 15:20427708-20427730 GAGGAGAATGGAAATCCCTGGGG No data
1123456125_1123456127 -6 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456127 15:20427689-20427711 TAGGGGTCCATGCCTCCCAGAGG No data
1123456125_1123456136 18 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456136 15:20427713-20427735 GAATGGAAATCCCTGGGGAATGG No data
1123456125_1123456129 1 Left 1123456125 15:20427672-20427694 CCTGGCTTGGAGGTCAGTAGGGG No data
Right 1123456129 15:20427696-20427718 CCATGCCTCCCAGAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123456125 Original CRISPR CCCCTACTGACCTCCAAGCC AGG (reversed) Intergenic
No off target data available for this crispr