ID: 1123460238

View in Genome Browser
Species Human (GRCh38)
Location 15:20463769-20463791
Sequence CCTGCTAACCAGACAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123460234_1123460238 -1 Left 1123460234 15:20463747-20463769 CCTTGCTGTACAAATTGTACCTC No data
Right 1123460238 15:20463769-20463791 CCTGCTAACCAGACAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123460238 Original CRISPR CCTGCTAACCAGACAGCAGA GGG Intergenic
No off target data available for this crispr