ID: 1123462287

View in Genome Browser
Species Human (GRCh38)
Location 15:20484137-20484159
Sequence TAGTCATTGGTACTTGCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123462287_1123462294 -6 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462294 15:20484154-20484176 TGACTACCTACGGGGAAATGGGG No data
1123462287_1123462295 -3 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG No data
1123462287_1123462299 5 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462299 15:20484165-20484187 GGGGAAATGGGGAGGGGACATGG No data
1123462287_1123462293 -7 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462293 15:20484153-20484175 ATGACTACCTACGGGGAAATGGG No data
1123462287_1123462296 -2 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462296 15:20484158-20484180 TACCTACGGGGAAATGGGGAGGG No data
1123462287_1123462301 19 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462301 15:20484179-20484201 GGGACATGGACAAAGGCAGCAGG No data
1123462287_1123462297 -1 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462297 15:20484159-20484181 ACCTACGGGGAAATGGGGAGGGG No data
1123462287_1123462292 -8 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462292 15:20484152-20484174 AATGACTACCTACGGGGAAATGG No data
1123462287_1123462300 12 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462300 15:20484172-20484194 TGGGGAGGGGACATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123462287 Original CRISPR TAGTCATTGGTACTTGCTTT CGG (reversed) Intergenic
No off target data available for this crispr