ID: 1123462296

View in Genome Browser
Species Human (GRCh38)
Location 15:20484158-20484180
Sequence TACCTACGGGGAAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123462287_1123462296 -2 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462296 15:20484158-20484180 TACCTACGGGGAAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123462296 Original CRISPR TACCTACGGGGAAATGGGGA GGG Intergenic
No off target data available for this crispr