ID: 1123462300

View in Genome Browser
Species Human (GRCh38)
Location 15:20484172-20484194
Sequence TGGGGAGGGGACATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123462291_1123462300 -1 Left 1123462291 15:20484150-20484172 CCAATGACTACCTACGGGGAAAT No data
Right 1123462300 15:20484172-20484194 TGGGGAGGGGACATGGACAAAGG No data
1123462287_1123462300 12 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462300 15:20484172-20484194 TGGGGAGGGGACATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123462300 Original CRISPR TGGGGAGGGGACATGGACAA AGG Intergenic
No off target data available for this crispr