ID: 1123462301

View in Genome Browser
Species Human (GRCh38)
Location 15:20484179-20484201
Sequence GGGACATGGACAAAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123462287_1123462301 19 Left 1123462287 15:20484137-20484159 CCGAAAGCAAGTACCAATGACTA No data
Right 1123462301 15:20484179-20484201 GGGACATGGACAAAGGCAGCAGG No data
1123462298_1123462301 -4 Left 1123462298 15:20484160-20484182 CCTACGGGGAAATGGGGAGGGGA No data
Right 1123462301 15:20484179-20484201 GGGACATGGACAAAGGCAGCAGG No data
1123462291_1123462301 6 Left 1123462291 15:20484150-20484172 CCAATGACTACCTACGGGGAAAT No data
Right 1123462301 15:20484179-20484201 GGGACATGGACAAAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123462301 Original CRISPR GGGACATGGACAAAGGCAGC AGG Intergenic
No off target data available for this crispr