ID: 1123466053

View in Genome Browser
Species Human (GRCh38)
Location 15:20516827-20516849
Sequence TCCTGGAGCAGGGTTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123466053_1123466061 3 Left 1123466053 15:20516827-20516849 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123466061 15:20516853-20516875 TCCAGTCTTTTGGTTTCCCTGGG 0: 8
1: 132
2: 905
3: 1022
4: 794
1123466053_1123466067 29 Left 1123466053 15:20516827-20516849 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123466067 15:20516879-20516901 CACTGGAAGAAGAATTGTCTTGG 0: 141
1: 382
2: 397
3: 233
4: 394
1123466053_1123466063 12 Left 1123466053 15:20516827-20516849 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123466063 15:20516862-20516884 TTGGTTTCCCTGGGCCACACTGG 0: 23
1: 354
2: 884
3: 838
4: 683
1123466053_1123466068 30 Left 1123466053 15:20516827-20516849 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123466068 15:20516880-20516902 ACTGGAAGAAGAATTGTCTTGGG 0: 130
1: 394
2: 410
3: 264
4: 747
1123466053_1123466060 2 Left 1123466053 15:20516827-20516849 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123466060 15:20516852-20516874 GTCCAGTCTTTTGGTTTCCCTGG 0: 10
1: 116
2: 894
3: 994
4: 751
1123466053_1123466058 -7 Left 1123466053 15:20516827-20516849 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1123466058 15:20516843-20516865 TCCAGGAGGGTCCAGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123466053 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG (reversed) Intergenic
No off target data available for this crispr