ID: 1123468541

View in Genome Browser
Species Human (GRCh38)
Location 15:20533680-20533702
Sequence GTTGCAGGAGACCCGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 6, 1: 0, 2: 2, 3: 30, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123468541_1123468548 -4 Left 1123468541 15:20533680-20533702 CCCTCAACCGGGTCTCCTGCAAC 0: 6
1: 0
2: 2
3: 30
4: 110
Right 1123468548 15:20533699-20533721 CAACTATTGGTGGGCCATCTCGG 0: 4
1: 3
2: 1
3: 17
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123468541 Original CRISPR GTTGCAGGAGACCCGGTTGA GGG (reversed) Intronic
905771696 1:40642164-40642186 CTTGCAGGTGACCGGTTTGATGG + Intronic
915276570 1:154792908-154792930 GTTGCCTGAGACCTGGCTGAAGG - Intronic
920112005 1:203593369-203593391 GTTTCAGGAGACTGGTTTGAGGG + Intergenic
924582845 1:245336347-245336369 GATGCAGGAGACCCGCTTGTAGG + Intronic
1065917692 10:30366504-30366526 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1069742907 10:70696853-70696875 GATGCAGGTGGCCCTGTTGAGGG + Intronic
1069905945 10:71732143-71732165 GCTGCAGAAGCCCTGGTTGAAGG - Intronic
1073284564 10:102379912-102379934 GATGGAGGAGACCCGGATGAGGG + Exonic
1076458704 10:130623463-130623485 GCTGCAGGAGACCCAGCTGCTGG + Intergenic
1080857601 11:36125891-36125913 TTTGCAGCAGATCAGGTTGAGGG - Intronic
1081356610 11:42121585-42121607 GTTGAAGGAGAAGGGGTTGAGGG - Intergenic
1083789339 11:64974303-64974325 GTGGCAGGAGATATGGTTGAGGG + Intergenic
1085259828 11:75198104-75198126 GGTGCAGAAGAACCTGTTGATGG + Intronic
1086909230 11:92452857-92452879 GTTGCTTGAGACCAGGTTGTGGG - Intronic
1090955739 11:131511656-131511678 GTTGCAGGACACCAGAATGATGG + Intronic
1091260829 11:134232870-134232892 GTTGCATGAGTCCTGGTCGATGG - Intronic
1093760514 12:22904179-22904201 GTTGCAGGAAGCACGGCTGATGG + Intergenic
1096112981 12:49040095-49040117 GTGGCGGGAGACCAGGCTGAGGG + Exonic
1097149878 12:56968810-56968832 GTGGCAGGAGAACAGGGTGATGG + Intergenic
1100980532 12:100158951-100158973 GTTGCGGGAGACCCAGGTGAGGG - Intergenic
1101278633 12:103227545-103227567 GGTGAAGGAGAAGCGGTTGAGGG + Intergenic
1101308571 12:103555424-103555446 GTTGTAGGAGACCCGGTGGGAGG - Intergenic
1101822685 12:108195992-108196014 GCTGCAGGAGGCCCAGCTGAGGG + Exonic
1102638366 12:114344544-114344566 GCTGCAGGAGACCTGGAGGATGG + Intergenic
1103839688 12:123852099-123852121 GTTGCAGGAGTTAGGGTTGAGGG - Intronic
1104779930 12:131413561-131413583 GCTGCAGGAGCCCAGGGTGAGGG - Intergenic
1108913646 13:55583077-55583099 GTTGAAGGAGAAGGGGTTGAGGG + Intergenic
1115018418 14:28645142-28645164 GAGGCAGGAGAACCGCTTGAAGG + Intergenic
1116504202 14:45658674-45658696 GTTGCAGGATACAGGGTTAATGG - Intergenic
1123468541 15:20533680-20533702 GTTGCAGGAGACCCGGTTGAGGG - Intronic
1123473362 15:20570681-20570703 GTTGCAGGAGGCCCAGGGGAGGG + Intergenic
1123644646 15:22429672-22429694 GTTGCAGGAGGCCCAGGGGAGGG - Intergenic
1123649573 15:22467382-22467404 GTTGCAGGAGACCCGGTTGAGGG + Intronic
1123665966 15:22609580-22609602 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1123728859 15:23128891-23128913 GTTGCAGGAGACCCGGTTGAGGG - Intronic
1123733662 15:23165692-23165714 GTTGCAGGAGGCCCAGGGGAGGG + Intergenic
1123747023 15:23326356-23326378 GTTGCAGGAGACCCGGTTGAGGG - Intergenic
1123751791 15:23363067-23363089 GTTGCAGGAGGCCCAGGGGAGGG + Intronic
1123758004 15:23412040-23412062 GGGGCTGGAGACCCGGCTGAGGG - Intergenic
1124279292 15:28349672-28349694 GTTGCAGGAGACCCGGTTGAGGG - Intergenic
1124284161 15:28386991-28387013 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124298536 15:28524623-28524645 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124303406 15:28561936-28561958 GTTGCAGGAGACCCGGTTGAGGG + Intergenic
1124319788 15:28703993-28704015 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124482723 15:30091437-30091459 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124489176 15:30143508-30143530 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124520854 15:30405781-30405803 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124532304 15:30518378-30518400 GTTGCAGGAGACCCAGCTGAGGG + Intergenic
1124537806 15:30560438-30560460 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124544263 15:30612499-30612521 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124564226 15:30799935-30799957 GTTGCAGGAGACCCAGGGGAGGG + Intergenic
1124754353 15:32394816-32394838 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124760848 15:32447148-32447170 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124766349 15:32489267-32489289 GTTGCAGGAGACCCAGCTGAGGG - Intergenic
1124777786 15:32601915-32601937 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1125045525 15:35239611-35239633 GTTGAAGGAGAAGGGGTTGAGGG - Intronic
1125538558 15:40456824-40456846 GTTGCAGGAGTACCTGGTGAGGG + Intronic
1125735159 15:41919658-41919680 GCTGCAGGAGACACGTTTAATGG + Intronic
1127772881 15:62244775-62244797 GTTGCAGGAGACCCAGGAAAGGG - Intergenic
1127912900 15:63432849-63432871 GTAGCAGAAGACCAGGCTGAAGG + Intergenic
1129211588 15:74072895-74072917 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1129398816 15:75268189-75268211 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1129402424 15:75292465-75292487 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1129475966 15:75784899-75784921 GTTGCAGGAGACCTAGGGGAGGG + Intergenic
1129728708 15:77917170-77917192 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1130484977 15:84393865-84393887 GTTGCAGGAGACCCAGGGGAGGG + Intergenic
1130681418 15:86000333-86000355 GTTGCTGGAGAACTGGTTGTTGG - Intergenic
1131188292 15:90293732-90293754 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1131509889 15:93044136-93044158 GTGGCAGGAGACCCAGTGGATGG - Intronic
1132203194 15:99969139-99969161 CTTGCAGGTGTCCCGGCTGATGG + Intergenic
1132432667 15:101773699-101773721 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1137484490 16:48880456-48880478 TTTGCAGGAGACCTGTTGGAGGG + Intergenic
1137995723 16:53209526-53209548 GTTGCAGAATACCCAGGTGAGGG + Exonic
1141880560 16:86856218-86856240 TTTGCAGGAGACCAGGCTGGTGG - Intergenic
1142850437 17:2701957-2701979 GTTGCAGTCAACCCCGTTGAAGG + Exonic
1152452294 17:80389402-80389424 GAAGCAGGAGACCAGGGTGAGGG - Intronic
1153466825 18:5397324-5397346 GGTGCAGGAGACCGTGTTGGTGG - Exonic
1155186458 18:23391127-23391149 GATGCAGGAGAACCACTTGAAGG + Intronic
1155378336 18:25187814-25187836 GTCTCAGGAGACCCTGTAGATGG - Intronic
1163095788 19:15055978-15056000 GCTGCAGGTGACCCGGCGGATGG + Exonic
1164208032 19:23074087-23074109 GATGCAGGAGAATCGCTTGAAGG - Intergenic
1167574212 19:50309928-50309950 GTTGCAGGGGACCCAGGTGGGGG - Exonic
925662058 2:6213145-6213167 TGTGCAGGAGACCTGGCTGAGGG + Intergenic
925829141 2:7877808-7877830 GGTGAAGGAGAAGCGGTTGAGGG + Intergenic
926407534 2:12570657-12570679 GGTGAAGGAGAAGCGGTTGAGGG - Intergenic
932007054 2:67937704-67937726 GATGCAGGAAACCATGTTGAGGG + Intergenic
934580134 2:95431070-95431092 ATTGCAGGAGGCCAGGTTGTAGG - Intergenic
934599313 2:95645655-95645677 ATTGCAGGAGGCCAGGTTGTAGG + Intergenic
935367704 2:102312429-102312451 GTTGGAAAAGACCTGGTTGAGGG + Intronic
942903835 2:181157061-181157083 GTTGAAGGAGGCCTGGTGGAAGG - Intergenic
943281800 2:185944241-185944263 GTTACAGGGGACCCTGTAGAAGG + Intergenic
947271765 2:228344017-228344039 TTTCCAGGAAACCCAGTTGAAGG + Intergenic
947860520 2:233354539-233354561 GTTGCGGGGGACCCGGCGGAGGG - Exonic
1168793975 20:598754-598776 GTGGCAGGAGACTCGGGGGATGG + Intergenic
1176113666 20:63421947-63421969 GTGGCAGGCGACCCGGCTGGCGG - Intronic
1176298447 21:5086812-5086834 TTTGCAGGAAACCCGAGTGAAGG + Intergenic
1177117726 21:17105650-17105672 GTAGCTGGAGACCCGTTTGGAGG - Intergenic
1178753023 21:35322229-35322251 GTTACAAGTGACCCGGCTGAAGG - Intronic
1179858579 21:44175137-44175159 TTTGCAGGAAACCCGAGTGAAGG - Intergenic
1180992003 22:19942330-19942352 GTTGCAGGAGGCCTGGGGGAGGG + Intronic
1181618060 22:24068473-24068495 GTGGCAGGATACCCCATTGATGG + Intronic
1181903394 22:26173518-26173540 GATGCAGGAGAGCAGGTTAATGG + Intronic
1182183866 22:28381163-28381185 GTGTCAGGAGACCCAGTAGAAGG + Intronic
1182739666 22:32558590-32558612 TTTGCAGAAGACCCAGATGAGGG - Intronic
950335200 3:12187694-12187716 GTAGGAGGAGACCTGATTGAAGG - Intronic
950610889 3:14125813-14125835 GTTGGAGGAGGCCTGGCTGAGGG + Intronic
953570407 3:44067048-44067070 GCACCAGGAGACCCGGGTGAAGG + Intergenic
954865237 3:53723391-53723413 CTTGCAGGAGACCCTGAGGATGG + Intronic
955403023 3:58607068-58607090 GTTGCAGGAGCCCTGGGTTAAGG - Intronic
961506125 3:127371584-127371606 GTTGCCTGAGACCCAGTGGACGG + Intergenic
976256932 4:83109529-83109551 GGTGGAGGAGCCCCTGTTGAGGG + Intronic
982073122 4:151713176-151713198 GTTGCAGGAAAACCAGCTGAGGG + Intronic
983631436 4:169853358-169853380 GTTGCAGGAGGCCTGGTGGGAGG + Intergenic
990148081 5:52785557-52785579 GTTGCAGGAAAACAGGCTGAGGG - Intergenic
998372119 5:141668688-141668710 GTTGTAGGAGACCTGGGAGAAGG + Intronic
1005755220 6:28920084-28920106 GTTGCAAGAGAACTGGGTGATGG + Exonic
1006550818 6:34821778-34821800 GTTGCAGTAGACCCGAGTGATGG - Exonic
1009595767 6:65733824-65733846 GTAGAAGGAGACACGGGTGAAGG + Intergenic
1011601321 6:89062839-89062861 ATTGCAGGAGACGGGGTTAAAGG - Intergenic
1013170672 6:107634496-107634518 GTTGCTGGAGAACCCGTTGGGGG - Exonic
1016522562 6:144962964-144962986 GTTCCAGGAGACTGGATTGAGGG - Intergenic
1016886495 6:148964454-148964476 GTTGGATAAGAACCGGTTGACGG - Exonic
1018560097 6:165093112-165093134 GTTGCAGGAGAACAAGTAGAGGG + Intergenic
1023869246 7:44254130-44254152 GCTGCTGGAGACCAGATTGAGGG - Intronic
1026977159 7:74505806-74505828 GTGGCAGGAAGCCCGCTTGAGGG - Intronic
1032281209 7:130503367-130503389 GGTGCAGGAGAGCTGGATGAGGG + Intronic
1038359647 8:26864670-26864692 GTTGCAGAAGACCCTGCCGAAGG + Exonic
1038363236 8:26904371-26904393 GTTGGAGGAGAGCCGGAAGAGGG + Intergenic
1039391062 8:37180999-37181021 CTTGCAGGACACCCAGTGGATGG - Intergenic
1043837489 8:85063789-85063811 GGTGAAGGAGAAGCGGTTGAGGG - Intergenic
1046563340 8:115867326-115867348 GTTGCAGCAGGCATGGTTGAGGG - Intergenic
1046928850 8:119823357-119823379 GTTGTGGGAGACCTGGTGGAAGG + Intronic
1048764447 8:137829594-137829616 GGTGAAGGAGACAGGGTTGAGGG + Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1053365265 9:37518302-37518324 GTTGCAGGAGATGCTGTTGTTGG + Exonic
1054809800 9:69425815-69425837 GTTGCAGGAAAACCAGTTCAGGG + Intergenic
1057216403 9:93231199-93231221 GGTGCAGGAGACCCAGTGGGAGG + Intronic
1057261553 9:93587463-93587485 GATGGAGGAGCCCCGGGTGAGGG + Intronic
1057261562 9:93587488-93587510 GATGGAGGAGCCCCGGGTGAGGG + Intronic
1057261576 9:93587535-93587557 GATGGAGGAGCCCCGGGTGAGGG + Intronic
1057429310 9:94979766-94979788 GTGGCAGGGGAGCAGGTTGAGGG + Intronic
1058554951 9:106157275-106157297 GTTGCAGGAGTCCTGGTTCTGGG - Intergenic
1061062833 9:128259160-128259182 GTTGCAGGAAACCCAGGTGAGGG - Exonic
1061445566 9:130635423-130635445 GTTGGAAGAGATCGGGTTGAAGG + Intronic
1198383606 X:136106602-136106624 TTTTCAGGAGACCCAGTAGATGG + Intergenic
1198884745 X:141322165-141322187 GAGGCAGGAAACCAGGTTGAAGG + Intergenic
1202373132 Y:24211420-24211442 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1202497650 Y:25458700-25458722 GTTGCAGGAGACCCAGGGGAGGG + Intergenic