ID: 1123471936

View in Genome Browser
Species Human (GRCh38)
Location 15:20562177-20562199
Sequence CTCCCCTCTCTTAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123471926_1123471936 5 Left 1123471926 15:20562149-20562171 CCTGCCCCTCTCCCAGAGTTGGC No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471924_1123471936 6 Left 1123471924 15:20562148-20562170 CCCTGCCCCTCTCCCAGAGTTGG No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471928_1123471936 1 Left 1123471928 15:20562153-20562175 CCCCTCTCCCAGAGTTGGCGGCC No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471929_1123471936 0 Left 1123471929 15:20562154-20562176 CCCTCTCCCAGAGTTGGCGGCCT No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471923_1123471936 10 Left 1123471923 15:20562144-20562166 CCGGCCCTGCCCCTCTCCCAGAG No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471930_1123471936 -1 Left 1123471930 15:20562155-20562177 CCTCTCCCAGAGTTGGCGGCCTC No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471932_1123471936 -7 Left 1123471932 15:20562161-20562183 CCAGAGTTGGCGGCCTCTCCCCT No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data
1123471931_1123471936 -6 Left 1123471931 15:20562160-20562182 CCCAGAGTTGGCGGCCTCTCCCC No data
Right 1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123471936 Original CRISPR CTCCCCTCTCTTAGAGTGGG TGG Intergenic
No off target data available for this crispr