ID: 1123472046

View in Genome Browser
Species Human (GRCh38)
Location 15:20562705-20562727
Sequence CTGCCCTCACCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123472035_1123472046 28 Left 1123472035 15:20562654-20562676 CCACCAAAGTTTTGCCAGTCAGC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472043_1123472046 -1 Left 1123472043 15:20562683-20562705 CCTTCAGCAAGCAGCCCAGTCTC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472033_1123472046 30 Left 1123472033 15:20562652-20562674 CCCCACCAAAGTTTTGCCAGTCA No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472034_1123472046 29 Left 1123472034 15:20562653-20562675 CCCACCAAAGTTTTGCCAGTCAG No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472042_1123472046 0 Left 1123472042 15:20562682-20562704 CCCTTCAGCAAGCAGCCCAGTCT No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472039_1123472046 5 Left 1123472039 15:20562677-20562699 CCCACCCCTTCAGCAAGCAGCCC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472038_1123472046 6 Left 1123472038 15:20562676-20562698 CCCCACCCCTTCAGCAAGCAGCC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472041_1123472046 1 Left 1123472041 15:20562681-20562703 CCCCTTCAGCAAGCAGCCCAGTC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472037_1123472046 14 Left 1123472037 15:20562668-20562690 CCAGTCAGCCCCACCCCTTCAGC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472036_1123472046 25 Left 1123472036 15:20562657-20562679 CCAAAGTTTTGCCAGTCAGCCCC No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data
1123472040_1123472046 4 Left 1123472040 15:20562678-20562700 CCACCCCTTCAGCAAGCAGCCCA No data
Right 1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123472046 Original CRISPR CTGCCCTCACCAATCACCCC AGG Intergenic
No off target data available for this crispr