ID: 1123472494

View in Genome Browser
Species Human (GRCh38)
Location 15:20565498-20565520
Sequence CAGGCTAGCACTTCCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123472494_1123472497 -9 Left 1123472494 15:20565498-20565520 CCTCTTGGGGAAGTGCTAGCCTG No data
Right 1123472497 15:20565512-20565534 GCTAGCCTGACTGGTTGTCAGGG No data
1123472494_1123472498 -8 Left 1123472494 15:20565498-20565520 CCTCTTGGGGAAGTGCTAGCCTG No data
Right 1123472498 15:20565513-20565535 CTAGCCTGACTGGTTGTCAGGGG No data
1123472494_1123472496 -10 Left 1123472494 15:20565498-20565520 CCTCTTGGGGAAGTGCTAGCCTG No data
Right 1123472496 15:20565511-20565533 TGCTAGCCTGACTGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123472494 Original CRISPR CAGGCTAGCACTTCCCCAAG AGG (reversed) Intergenic
No off target data available for this crispr