ID: 1123473634

View in Genome Browser
Species Human (GRCh38)
Location 15:20571948-20571970
Sequence CGGCTTTATGGACCACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123473625_1123473634 10 Left 1123473625 15:20571915-20571937 CCGAGATGTGACCCCATTATTTT No data
Right 1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG No data
1123473628_1123473634 -2 Left 1123473628 15:20571927-20571949 CCCATTATTTTGGCTCCAGAGCG No data
Right 1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG No data
1123473629_1123473634 -3 Left 1123473629 15:20571928-20571950 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG No data
1123473624_1123473634 28 Left 1123473624 15:20571897-20571919 CCTGAGGGCAGGTCGCTGCCGAG No data
Right 1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG No data
1123473627_1123473634 -1 Left 1123473627 15:20571926-20571948 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123473634 Original CRISPR CGGCTTTATGGACCACCTGG AGG Intergenic
No off target data available for this crispr