ID: 1123476430

View in Genome Browser
Species Human (GRCh38)
Location 15:20594921-20594943
Sequence CAATCAGAGGCCTCTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123476430_1123476437 11 Left 1123476430 15:20594921-20594943 CCAGTCAGAGAGGCCTCTGATTG No data
Right 1123476437 15:20594955-20594977 CAGCTGACTGGGACCCTCTTGGG No data
1123476430_1123476435 0 Left 1123476430 15:20594921-20594943 CCAGTCAGAGAGGCCTCTGATTG No data
Right 1123476435 15:20594944-20594966 CTCATGGGTGTCAGCTGACTGGG No data
1123476430_1123476434 -1 Left 1123476430 15:20594921-20594943 CCAGTCAGAGAGGCCTCTGATTG No data
Right 1123476434 15:20594943-20594965 GCTCATGGGTGTCAGCTGACTGG No data
1123476430_1123476436 10 Left 1123476430 15:20594921-20594943 CCAGTCAGAGAGGCCTCTGATTG No data
Right 1123476436 15:20594954-20594976 TCAGCTGACTGGGACCCTCTTGG No data
1123476430_1123476438 20 Left 1123476430 15:20594921-20594943 CCAGTCAGAGAGGCCTCTGATTG No data
Right 1123476438 15:20594964-20594986 GGGACCCTCTTGGGACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123476430 Original CRISPR CAATCAGAGGCCTCTCTGAC TGG (reversed) Intergenic
No off target data available for this crispr