ID: 1123480237

View in Genome Browser
Species Human (GRCh38)
Location 15:20624384-20624406
Sequence TGGCAAGTGCAGGAACTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123480229_1123480237 14 Left 1123480229 15:20624347-20624369 CCCTGGAGCTCCATATGCACTGA No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480224_1123480237 28 Left 1123480224 15:20624333-20624355 CCAGGGGGCCCCTCCCCTGGAGC No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480227_1123480237 18 Left 1123480227 15:20624343-20624365 CCTCCCCTGGAGCTCCATATGCA No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480226_1123480237 19 Left 1123480226 15:20624342-20624364 CCCTCCCCTGGAGCTCCATATGC No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480228_1123480237 15 Left 1123480228 15:20624346-20624368 CCCCTGGAGCTCCATATGCACTG No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480225_1123480237 20 Left 1123480225 15:20624341-20624363 CCCCTCCCCTGGAGCTCCATATG No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480230_1123480237 13 Left 1123480230 15:20624348-20624370 CCTGGAGCTCCATATGCACTGAT No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data
1123480231_1123480237 4 Left 1123480231 15:20624357-20624379 CCATATGCACTGATACCTCCAGA No data
Right 1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123480237 Original CRISPR TGGCAAGTGCAGGAACTGAT GGG Intergenic
No off target data available for this crispr