ID: 1123480683

View in Genome Browser
Species Human (GRCh38)
Location 15:20628734-20628756
Sequence CGCCGCCCGAGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123480683_1123480695 8 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480683_1123480696 11 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG No data
Right 1123480696 15:20628768-20628790 GACTGCGCCGCTCACAGCGGCGG No data
1123480683_1123480698 26 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123480683 Original CRISPR CGCCGCCCGAGGAGAACGGG AGG (reversed) Intergenic