ID: 1123480683

View in Genome Browser
Species Human (GRCh38)
Location 15:20628734-20628756
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123480683_1123480695 8 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480683_1123480698 26 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480683_1123480696 11 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1123480696 15:20628768-20628790 GACTGCGCCGCTCACAGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123480683 Original CRISPR CGCCGCCCGAGGAGAACGGG AGG (reversed) Intergenic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900945142 1:5826818-5826840 CGAGGCCCGAGGAAAGCGGGAGG + Intergenic
902180317 1:14683390-14683412 AGCCCCCGGAGGAGAATGGGTGG - Intronic
903331872 1:22600708-22600730 CGCTGGCCGAGGAGAAGGTGCGG - Exonic
904128630 1:28259892-28259914 CGCCGCCCGGGGCGAACCGCAGG - Exonic
904199756 1:28812176-28812198 CTCCGGGCGAGGAGAGCGGGCGG + Exonic
910670024 1:89763192-89763214 CGCCACCCGAGGACACGGGGAGG + Intronic
914790791 1:150876243-150876265 CGCCGACCGAGGAGTGAGGGCGG + Intronic
915165708 1:153946674-153946696 CGCCGGCCGAGGAGGAGGGGTGG - Exonic
922950901 1:229558215-229558237 CGCCTCCCGGGGACAAGGGGCGG - Exonic
924194418 1:241590868-241590890 CTGCCCCCGAGGAGAACAGGAGG + Intronic
1065110748 10:22437487-22437509 CGCCTCCCGCGGAAAGCGGGCGG - Intronic
1076808124 10:132869625-132869647 CGCCGTCCGAGGAGAAGAGGAGG + Intronic
1077581879 11:3422473-3422495 TGGTGCCCGAGGAGAACGCGGGG - Intergenic
1077633756 11:3827857-3827879 CGCCGTCCTATGAGAACGTGCGG - Exonic
1080540459 11:33258608-33258630 CGCCGCACTGGGAGAACTGGCGG + Intronic
1083366547 11:62144971-62144993 CGCCACCCCAGGAGAAGGAGCGG + Exonic
1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG + Intronic
1084238789 11:67805290-67805312 TGGCGCCCGAGGAGAACGCGGGG - Intergenic
1084758248 11:71252376-71252398 CGCGGGCCGGGGAGGACGGGAGG - Intronic
1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG + Exonic
1098255443 12:68611105-68611127 CGCCGGCTGAGGGGAGCGGGTGG + Intronic
1105964465 13:25372119-25372141 CGCCGCCCGAGGACCATGGGTGG - Exonic
1113379117 13:109786767-109786789 CGCGGCCCGGGGAGAAAGGGGGG - Intergenic
1123014591 14:105367733-105367755 CCCCGCCTGAGGAGTAGGGGAGG - Intronic
1123480683 15:20628734-20628756 CGCCGCCCGAGGAGAACGGGAGG - Intergenic
1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG + Intergenic
1129677087 15:77637462-77637484 CCCCGCCCGAGGGGAAGGTGAGG - Intronic
1131832259 15:96361360-96361382 CTCCCCCAGAGGAGAAAGGGGGG - Intergenic
1133156769 16:3881096-3881118 CGCCGCCCCAGCGGGACGGGCGG - Intergenic
1133350453 16:5097716-5097738 TGGCGCCCGAGGAGAACGCGGGG - Exonic
1136025882 16:27468961-27468983 GGCCGCCCGTGGAGAGTGGGCGG + Intronic
1142859952 17:2755522-2755544 CGCCGGCCCCGCAGAACGGGCGG - Intergenic
1143543660 17:7583764-7583786 CGCCGCGGGAAAAGAACGGGAGG + Exonic
1146872661 17:36386062-36386084 TGTAGCCCTAGGAGAACGGGGGG - Intronic
1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG + Exonic
1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG + Intronic
1149847589 17:60016662-60016684 TGTAGCCCTAGGAGAACGGGGGG - Intergenic
1150085947 17:62273279-62273301 TGTAGCCCTAGGAGAACGGGGGG - Intronic
1157464245 18:47930623-47930645 CGCCGCCCGCGGGGAAGGAGGGG + Intronic
1157685753 18:49641024-49641046 CGCAGCACGAGGAGACCCGGAGG - Intergenic
1160242668 18:77134063-77134085 AGCTGCCCTAGGAGCACGGGTGG + Intergenic
1160763755 19:798103-798125 CGCGGCCCGGGGCGCACGGGGGG - Intronic
1160764479 19:801324-801346 CGGCGCCCCAGCAGAACGGAAGG - Intronic
1162818438 19:13209388-13209410 TCCCGCCCGAGGAGAACCAGCGG - Exonic
1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG + Intronic
1165476275 19:36032686-36032708 GGCGGCCCGCGGAGAAGGGGAGG - Intronic
1165760056 19:38315831-38315853 GGCCGGCGGAGGAGATCGGGCGG - Intronic
1168538520 19:57191699-57191721 CGCCGCCCCTGGAGACCGCGGGG - Exonic
934678247 2:96265323-96265345 CGCCGGCGGAGGAGCCCGGGAGG - Exonic
948763752 2:240208970-240208992 AGCAGCCCGAGGAGAGAGGGAGG + Intergenic
948824588 2:240568233-240568255 CGCCGCCCGGGGAGGAAGCGAGG + Intronic
1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG + Intergenic
1175847247 20:62065406-62065428 CGCCGCCCGAGGGCAGCGCGGGG - Exonic
1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG + Intergenic
1180707383 22:17817960-17817982 CCCTGGCCAAGGAGAACGGGAGG - Exonic
1181168037 22:20993684-20993706 CGCTGCACGAGGACTACGGGCGG + Exonic
953246601 3:41199400-41199422 CGCCGCGCGAGGACAAGGGGCGG - Intronic
956322050 3:68008015-68008037 GGCCGCCCCGGGAGAAGGGGTGG + Intronic
957054741 3:75435087-75435109 TGGCGCCCGAGGAGAATGCGGGG - Intergenic
961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG + Intergenic
961572046 3:127806234-127806256 CACAGCCCAAGGAGAACGGCAGG - Intronic
963045693 3:141101154-141101176 AGCCCCCCGAGGAGAATGGTGGG + Intronic
968942024 4:3643842-3643864 GGCCGCCCGAGGAGACCTAGGGG + Intergenic
968997549 4:3955396-3955418 TGGCGCCCTAGGAGAACGCGGGG - Intergenic
969756462 4:9153297-9153319 TGGCGCCCGAGGAGAACGCGGGG + Intergenic
984024068 4:174522279-174522301 CGCCGCCCGAGGTGCACTGGCGG - Intronic
984888956 4:184474586-184474608 CGCGGCCGGAGGAGGGCGGGGGG - Intergenic
985783533 5:1882654-1882676 CGCGGCCCGGGGCGGACGGGCGG + Exonic
985997839 5:3606565-3606587 CCCCGCCCGAGGGGAAGGAGGGG - Intergenic
998228786 5:140346247-140346269 CGACGCCCCCGGAGATCGGGGGG - Intronic
1000220460 5:159209309-159209331 CGCCGCCCGAGGAGAACGGGAGG - Intronic
1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG + Intronic
1006331055 6:33391484-33391506 GGCGGCCGGAGGAGAAGGGGCGG - Intergenic
1019343461 7:519057-519079 CGCCGCCACAGGAGACCGGCTGG - Exonic
1021450332 7:20778262-20778284 CGCAGCCCGAGGGGAGCGGCGGG + Intergenic
1033300084 7:140177312-140177334 CGCAGCCGGAGGAGGACGGCGGG + Intergenic
1036849865 8:12194047-12194069 TGGCGCCCGAGGAGAACGCGGGG - Exonic
1036871229 8:12436320-12436342 TGGCGCCCGAGGAGAACGCGGGG - Exonic
1041449698 8:57994290-57994312 CGCCGACCGAGTGGAATGGGGGG + Intergenic
1048581441 8:135732468-135732490 CGCCTCCAAAGGAGACCGGGAGG - Intergenic
1049585387 8:143430479-143430501 CGCCGCCCGCGGGGAGCAGGGGG - Intergenic
1052903833 9:33817320-33817342 CGGCCCCCGAAGAGAACGAGAGG + Intergenic
1057533482 9:95875725-95875747 CGCCGCCGGAGGAGGACAGGAGG - Exonic
1061259903 9:129474501-129474523 CACAGCCCAAGGAGAACTGGTGG - Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1198636866 X:138711180-138711202 CGCCGCCGGAGGAGCTCGGACGG - Exonic