ID: 1123480695

View in Genome Browser
Species Human (GRCh38)
Location 15:20628765-20628787
Sequence CGGGACTGCGCCGCTCACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123480683_1123480695 8 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480674_1123480695 27 Left 1123480674 15:20628715-20628737 CCCCGGCTCTCTCGCCCGCCCTC No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480685_1123480695 5 Left 1123480685 15:20628737-20628759 CCCGTTCTCCTCGGGCGGCGGCG No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480676_1123480695 25 Left 1123480676 15:20628717-20628739 CCGGCTCTCTCGCCCGCCCTCCC No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480675_1123480695 26 Left 1123480675 15:20628716-20628738 CCCGGCTCTCTCGCCCGCCCTCC No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480691_1123480695 -3 Left 1123480691 15:20628745-20628767 CCTCGGGCGGCGGCGGGGGCCGG No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480678_1123480695 13 Left 1123480678 15:20628729-20628751 CCCGCCCTCCCGTTCTCCTCGGG No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480680_1123480695 12 Left 1123480680 15:20628730-20628752 CCGCCCTCCCGTTCTCCTCGGGC No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480686_1123480695 4 Left 1123480686 15:20628738-20628760 CCGTTCTCCTCGGGCGGCGGCGG No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data
1123480682_1123480695 9 Left 1123480682 15:20628733-20628755 CCCTCCCGTTCTCCTCGGGCGGC No data
Right 1123480695 15:20628765-20628787 CGGGACTGCGCCGCTCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123480695 Original CRISPR CGGGACTGCGCCGCTCACAG CGG Intergenic