ID: 1123480698

View in Genome Browser
Species Human (GRCh38)
Location 15:20628783-20628805
Sequence AGCGGCGGCTCTTCTGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123480694_1123480698 -4 Left 1123480694 15:20628764-20628786 CCGGGACTGCGCCGCTCACAGCG No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480691_1123480698 15 Left 1123480691 15:20628745-20628767 CCTCGGGCGGCGGCGGGGGCCGG No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480686_1123480698 22 Left 1123480686 15:20628738-20628760 CCGTTCTCCTCGGGCGGCGGCGG No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480685_1123480698 23 Left 1123480685 15:20628737-20628759 CCCGTTCTCCTCGGGCGGCGGCG No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480682_1123480698 27 Left 1123480682 15:20628733-20628755 CCCTCCCGTTCTCCTCGGGCGGC No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480683_1123480698 26 Left 1123480683 15:20628734-20628756 CCTCCCGTTCTCCTCGGGCGGCG No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data
1123480680_1123480698 30 Left 1123480680 15:20628730-20628752 CCGCCCTCCCGTTCTCCTCGGGC No data
Right 1123480698 15:20628783-20628805 AGCGGCGGCTCTTCTGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123480698 Original CRISPR AGCGGCGGCTCTTCTGCGCC CGG Intergenic