ID: 1123482027

View in Genome Browser
Species Human (GRCh38)
Location 15:20640897-20640919
Sequence GGCTGCCCCAAAGTTCCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123482027_1123482030 2 Left 1123482027 15:20640897-20640919 CCGATGGGAACTTTGGGGCAGCC No data
Right 1123482030 15:20640922-20640944 TATTTTTTTTTAGGATTCTGTGG No data
1123482027_1123482028 -7 Left 1123482027 15:20640897-20640919 CCGATGGGAACTTTGGGGCAGCC No data
Right 1123482028 15:20640913-20640935 GGCAGCCTCTATTTTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123482027 Original CRISPR GGCTGCCCCAAAGTTCCCAT CGG (reversed) Intergenic
No off target data available for this crispr