ID: 1123482399

View in Genome Browser
Species Human (GRCh38)
Location 15:20644265-20644287
Sequence CTTCCTCCCAGCAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123482390_1123482399 8 Left 1123482390 15:20644234-20644256 CCACCCAGGTGGCCCCACCCTGA No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482389_1123482399 15 Left 1123482389 15:20644227-20644249 CCTGGATCCACCCAGGTGGCCCC No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482393_1123482399 -4 Left 1123482393 15:20644246-20644268 CCCCACCCTGAGCACTGAGCTTC No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482394_1123482399 -5 Left 1123482394 15:20644247-20644269 CCCACCCTGAGCACTGAGCTTCC No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482392_1123482399 4 Left 1123482392 15:20644238-20644260 CCAGGTGGCCCCACCCTGAGCAC No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482391_1123482399 5 Left 1123482391 15:20644237-20644259 CCCAGGTGGCCCCACCCTGAGCA No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482397_1123482399 -10 Left 1123482397 15:20644252-20644274 CCTGAGCACTGAGCTTCCTCCCA No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482396_1123482399 -9 Left 1123482396 15:20644251-20644273 CCCTGAGCACTGAGCTTCCTCCC No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data
1123482395_1123482399 -6 Left 1123482395 15:20644248-20644270 CCACCCTGAGCACTGAGCTTCCT No data
Right 1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123482399 Original CRISPR CTTCCTCCCAGCAAGGAGAC AGG Intergenic
No off target data available for this crispr