ID: 1123484862

View in Genome Browser
Species Human (GRCh38)
Location 15:20682252-20682274
Sequence AATAACTTCAGATTCCTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123484862_1123484864 17 Left 1123484862 15:20682252-20682274 CCCGAAAGGAATCTGAAGTTATT No data
Right 1123484864 15:20682292-20682314 CTAGCTCTTCCAGTTTCAATAGG No data
1123484862_1123484865 18 Left 1123484862 15:20682252-20682274 CCCGAAAGGAATCTGAAGTTATT No data
Right 1123484865 15:20682293-20682315 TAGCTCTTCCAGTTTCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123484862 Original CRISPR AATAACTTCAGATTCCTTTC GGG (reversed) Intergenic
No off target data available for this crispr