ID: 1123484864

View in Genome Browser
Species Human (GRCh38)
Location 15:20682292-20682314
Sequence CTAGCTCTTCCAGTTTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123484863_1123484864 16 Left 1123484863 15:20682253-20682275 CCGAAAGGAATCTGAAGTTATTC No data
Right 1123484864 15:20682292-20682314 CTAGCTCTTCCAGTTTCAATAGG No data
1123484862_1123484864 17 Left 1123484862 15:20682252-20682274 CCCGAAAGGAATCTGAAGTTATT No data
Right 1123484864 15:20682292-20682314 CTAGCTCTTCCAGTTTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123484864 Original CRISPR CTAGCTCTTCCAGTTTCAAT AGG Intergenic
No off target data available for this crispr