ID: 1123487170 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:20751745-20751767 |
| Sequence | GAGTCGTGGGAGAAGGTGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123487170_1123487176 | -6 | Left | 1123487170 | 15:20751745-20751767 | CCTACCACCTTCTCCCACGACTC | No data | ||
| Right | 1123487176 | 15:20751762-20751784 | CGACTCCAACATAAGAAAATGGG | No data | ||||
| 1123487170_1123487175 | -7 | Left | 1123487170 | 15:20751745-20751767 | CCTACCACCTTCTCCCACGACTC | No data | ||
| Right | 1123487175 | 15:20751761-20751783 | ACGACTCCAACATAAGAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123487170 | Original CRISPR | GAGTCGTGGGAGAAGGTGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||