ID: 1123487170

View in Genome Browser
Species Human (GRCh38)
Location 15:20751745-20751767
Sequence GAGTCGTGGGAGAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123487170_1123487176 -6 Left 1123487170 15:20751745-20751767 CCTACCACCTTCTCCCACGACTC No data
Right 1123487176 15:20751762-20751784 CGACTCCAACATAAGAAAATGGG No data
1123487170_1123487175 -7 Left 1123487170 15:20751745-20751767 CCTACCACCTTCTCCCACGACTC No data
Right 1123487175 15:20751761-20751783 ACGACTCCAACATAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123487170 Original CRISPR GAGTCGTGGGAGAAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr