ID: 1123487748

View in Genome Browser
Species Human (GRCh38)
Location 15:20756197-20756219
Sequence CGGGTCTCCGCCTGTTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123487745_1123487748 -10 Left 1123487745 15:20756184-20756206 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123487748 15:20756197-20756219 CGGGTCTCCGCCTGTTGGACGGG No data
1123487734_1123487748 22 Left 1123487734 15:20756152-20756174 CCGCGCGCACGCTCGGGCGCTGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1123487748 15:20756197-20756219 CGGGTCTCCGCCTGTTGGACGGG No data
1123487733_1123487748 23 Left 1123487733 15:20756151-20756173 CCCGCGCGCACGCTCGGGCGCTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1123487748 15:20756197-20756219 CGGGTCTCCGCCTGTTGGACGGG No data
1123487742_1123487748 -3 Left 1123487742 15:20756177-20756199 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123487748 15:20756197-20756219 CGGGTCTCCGCCTGTTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123487748 Original CRISPR CGGGTCTCCGCCTGTTGGAC GGG Intergenic
No off target data available for this crispr