ID: 1123492056

View in Genome Browser
Species Human (GRCh38)
Location 15:20788677-20788699
Sequence CCTCTATCACAGAGAATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123492056_1123492068 19 Left 1123492056 15:20788677-20788699 CCTGATATTCTCTGTGATAGAGG No data
Right 1123492068 15:20788719-20788741 CCCGGGGGAGCCCAGAACCATGG No data
1123492056_1123492061 2 Left 1123492056 15:20788677-20788699 CCTGATATTCTCTGTGATAGAGG No data
Right 1123492061 15:20788702-20788724 ACAGCCCTCCTCAGAGACCCGGG No data
1123492056_1123492062 3 Left 1123492056 15:20788677-20788699 CCTGATATTCTCTGTGATAGAGG No data
Right 1123492062 15:20788703-20788725 CAGCCCTCCTCAGAGACCCGGGG No data
1123492056_1123492060 1 Left 1123492056 15:20788677-20788699 CCTGATATTCTCTGTGATAGAGG No data
Right 1123492060 15:20788701-20788723 GACAGCCCTCCTCAGAGACCCGG No data
1123492056_1123492063 4 Left 1123492056 15:20788677-20788699 CCTGATATTCTCTGTGATAGAGG No data
Right 1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123492056 Original CRISPR CCTCTATCACAGAGAATATC AGG (reversed) Intergenic
No off target data available for this crispr