ID: 1123492063

View in Genome Browser
Species Human (GRCh38)
Location 15:20788704-20788726
Sequence AGCCCTCCTCAGAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123492056_1123492063 4 Left 1123492056 15:20788677-20788699 CCTGATATTCTCTGTGATAGAGG No data
Right 1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123492063 Original CRISPR AGCCCTCCTCAGAGACCCGG GGG Intergenic
No off target data available for this crispr